Which behavior would best describe someone who has good communication skills with customers? O a) Following up with some customers

4 answers
Question:

Which behavior would best describe someone who has good communication skills with customers? O a) Following up with some customers b) Talking to customers more than listening to them C) Repeating back what the customer says O d) Interrupting customers frequently

Answers

(1/x + 1)^2 + 6 (1/x + 1) +5

The density of the cube is 40

addition

step-by-step explanation:

[tex]Will pay paypal money to whom answers all! answer first[/tex]

answer: apothems is your answer

step-by-step explanation: hope u get it right

Similar Solved Works

1 answer

Convert 0.15 moles of NaCl into grams.

Convert 0.15 moles of NaCl into grams....
4 answers

When doing an experiment, scientists must record detailed & precise data. Why?

When doing an experiment, scientists must record detailed & precise data. Why?...
4 answers

If 44.5 L of nitrogen at 742 mm Hg are compressed to 536 mm Hg at constant temperature. what is the new volume ?

if 44.5 L of nitrogen at 742 mm Hg are compressed to 536 mm Hg at constant temperature. what is the new volume ?...
10 answers

In order to make some extra money in the summer, you water your neighbor's lawn and walk their dog.

In order to make some extra money in the summer, you water your neighbor's lawn and walk their dog. you water their lawn every 6 days and walk the dog every 4 days. your neighbor pays you $5 each time you walk the dog and $6 each time you water the lawn. when you do both jobs on the same day. she gi...
7 answers

Apply the definition of subtraction and properties of operations to find the result. 1/3-2/9-1/3

Apply the definition of subtraction and properties of operations to find the result. 1/3-2/9-1/3...
4 answers

The system of linear equations y=2x-1andy=-4x-1 is graphed below.The system of linear equations and is graphed below.

The system of linear equations y=2x-1andy=-4x-1 is graphed below. The system of linear equations and is graphed below....
4 answers

Why are media potentially so effective? a. their quality is controlled by the government. b. media are

Why are media potentially so effective? a. their quality is controlled by the government. b. media are all around us. c. they don't cost anything to use. d. all of the above....
4 answers

Which form of ser is appropriate for the following sentence? mis abuelos muy amables. (3 points) es son soy somos

Which form of ser is appropriate for the following sentence? mis abuelos muy amables. (3 points) es son soy somos...
8 answers

Justin bought 3 shirts for $18 each, 2 pair of socks for $3.99 a pair, and a pair ofslacks for $45.00. The sales tax rate

Justin bought 3 shirts for $18 each, 2 pair of socks for $3.99 a pair, and a pair of slacks for $45.00. The sales tax rate is 8.5%. How much did he pay?...
10 answers

What are the units of speed or velocity

What are the units of speed or velocity...
10 answers

How do you do this question

How do you do this question [tex]How do you do this question[/tex]...
3 answers

Pay attention to the question that is being asked. You will be asked to go from DNA to DNA,DNA to RNA, or RNA to RNA.1.Go

Pay attention to the question that is being asked. You will be asked to go from DNA to DNA, DNA to RNA, or RNA to RNA. 1. Go from DNA to DNA for the following strands a. AAATCCGTCGTTACACACACAACA b. TTATATATATAGCGCGCGCGCGCGCGC c. CGAT d. GCGCGCGCGCGCGCGCGCGCGCGCGCGCG [tex]Pay attention to t...
3 answers

Which of the following is a vector?7 meters0.007 cm7x 106m7 miles Northwest

Which of the following is a vector? 7 meters 0.007 cm 7x 106m 7 miles Northwest...
10 answers

I NEED HELP ASAPWhat are the measures of angles 1, 2, and 3?

I NEED HELP ASAPWhat are the measures of angles 1, 2, and 3? [tex]I NEED HELP ASAPPPPWhat are the measures of angles 1, 2, and 3?[/tex]...
3 answers

Why is stuffy pete practically in tears

Why is stuffy pete practically in tears...
3 answers

Anewspaper claims that 52% of voters will vote for a particular candidate in an upcoming election. a random survey of 1000

Anewspaper claims that 52% of voters will vote for a particular candidate in an upcoming election. a random survey of 1000 voters shows that 48% will vote for that candidate, with a standard deviation of 3%. compute the corresponding z-value....
4 answers

Which often influences the buying behavior of consumers in different parts of the world?

Which often influences the buying behavior of consumers in different parts of the world?...
3 answers

A plant is already 57cm talk and it will grow one centimeter every month the plant height h in centimeters after m months is

A plant is already 57cm talk and it will grow one centimeter every month the plant height h in centimeters after m months is given by the following function what is the plants height after 22 months...
4 answers

Consider two lines. Line A is given by the function f(x) - 4x - 9, while Line B contains the points (0,5) and (2, 12). Which

Consider two lines. Line A is given by the function f(x) - 4x - 9, while Line B contains the points (0,5) and (2, 12). Which statement is true?...
5 answers

For the quadratic function f(x)=x^2-6x-27, determine and accurately express each of the key features

For the quadratic function f(x)=x^2-6x-27, determine and accurately express each of the key features listed below. 1 WRiteTHE ORDERED PAIR WHICH CORRESPONDS TO THE PARABOLAS y intercept. 2. Write the ordered pair which corresponds to the parabodas vertex...

-- 0.057137--