Which behavior would best describe someone who has good communication skills with customers? O a) Following up with some customers
4 answers
Question:
Which behavior would best describe someone who has good communication skills with customers? O a) Following up with some customers b) Talking to customers more than listening to them C) Repeating back what the customer says O d) Interrupting customers frequently
Answers
(1/x + 1)^2 + 6 (1/x + 1) +5
The density of the cube is 40
addition
step-by-step explanation:
[tex]Will pay paypal money to whom answers all! answer first[/tex]answer: apothems is your answer
step-by-step explanation: hope u get it right
Similar Solved Works
4 answers
When doing an experiment, scientists must record detailed & precise data. Why?
When doing an experiment, scientists must record detailed & precise data. Why?...
4 answers
If 44.5 L of nitrogen at 742 mm Hg are compressed to 536 mm Hg at constant temperature. what is the new volume ?
if 44.5 L of nitrogen at 742 mm Hg are compressed to 536 mm Hg at constant temperature. what is the new volume ?...
10 answers
In order to make some extra money in the summer, you water your neighbor's lawn and walk their dog.
In order to make some extra money in the summer, you water your neighbor's lawn and walk their dog. you water their lawn every 6 days and walk the dog every 4 days. your neighbor pays you $5 each time you walk the dog and $6 each time you water the lawn. when you do both jobs on the same day. she gi...
7 answers
Apply the definition of subtraction and properties of operations to find the result. 1/3-2/9-1/3
Apply the definition of subtraction and properties of operations to find the result. 1/3-2/9-1/3...
4 answers
The system of linear equations y=2x-1andy=-4x-1 is graphed below.The system of linear equations and is graphed below.
The system of linear equations y=2x-1andy=-4x-1 is graphed below. The system of linear equations and is graphed below....
4 answers
Why are media potentially so effective? a. their quality is controlled by the government. b. media are
Why are media potentially so effective? a. their quality is controlled by the government. b. media are all around us. c. they don't cost anything to use. d. all of the above....
4 answers
Which form of ser is appropriate for the following sentence? mis abuelos muy amables. (3 points) es son soy somos
Which form of ser is appropriate for the following sentence? mis abuelos muy amables. (3 points) es son soy somos...
8 answers
Justin bought 3 shirts for $18 each, 2 pair of socks for $3.99 a pair, and a pair ofslacks for $45.00. The sales tax rate
Justin bought 3 shirts for $18 each, 2 pair of socks for $3.99 a pair, and a pair of slacks for $45.00. The sales tax rate is 8.5%. How much did he pay?...
10 answers
How do you do this question
How do you do this question [tex]How do you do this question[/tex]...
3 answers
Pay attention to the question that is being asked. You will be asked to go from DNA to DNA,DNA to RNA, or RNA to RNA.1.Go
Pay attention to the question that is being asked. You will be asked to go from DNA to DNA, DNA to RNA, or RNA to RNA. 1. Go from DNA to DNA for the following strands a. AAATCCGTCGTTACACACACAACA b. TTATATATATAGCGCGCGCGCGCGCGC c. CGAT d. GCGCGCGCGCGCGCGCGCGCGCGCGCGCG [tex]Pay attention to t...
3 answers
Which of the following is a vector?7 meters0.007 cm7x 106m7 miles Northwest
Which of the following is a vector? 7 meters 0.007 cm 7x 106m 7 miles Northwest...
10 answers
I NEED HELP ASAPWhat are the measures of angles 1, 2, and 3?
I NEED HELP ASAPWhat are the measures of angles 1, 2, and 3? [tex]I NEED HELP ASAPPPPWhat are the measures of angles 1, 2, and 3?[/tex]...
3 answers
Anewspaper claims that 52% of voters will vote for a particular candidate in an upcoming election. a random survey of 1000
Anewspaper claims that 52% of voters will vote for a particular candidate in an upcoming election. a random survey of 1000 voters shows that 48% will vote for that candidate, with a standard deviation of 3%. compute the corresponding z-value....
4 answers
Which often influences the buying behavior of consumers in different parts of the world?
Which often influences the buying behavior of consumers in different parts of the world?...
3 answers
A plant is already 57cm talk and it will grow one centimeter every month the plant height h in centimeters after m months is
A plant is already 57cm talk and it will grow one centimeter every month the plant height h in centimeters after m months is given by the following function what is the plants height after 22 months...
4 answers
Consider two lines. Line A is given by the function f(x) - 4x - 9, while Line B contains the points (0,5) and (2, 12). Which
Consider two lines. Line A is given by the function f(x) - 4x - 9, while Line B contains the points (0,5) and (2, 12). Which statement is true?...
5 answers
For the quadratic function f(x)=x^2-6x-27, determine and accurately express each of the key features
For the quadratic function f(x)=x^2-6x-27, determine and accurately express each of the key features listed below. 1 WRiteTHE ORDERED PAIR WHICH CORRESPONDS TO THE PARABOLAS y intercept. 2. Write the ordered pair which corresponds to the parabodas vertex...