Jace invested $380 in an account paying an interest rate of 6.2% compounded continuously. Assuming no deposits or withdrawals are made,
3 answers
Question:
Jace invested $380 in an account paying an interest rate of 6.2% compounded continuously. Assuming no deposits or withdrawals are made, how much money, to the nearest ten dollars, would be in the account after 15 years?
Answers
960
Step-by-step explanation:
[tex]Jace invested $380 in an account paying an interest rate of 6.2% compounded continuously. Assuming n[/tex]
1. 22
2. 1
3. 7
4. 18
step-by-step explanation
e2020 got it right
When i did the math i got 11 cm
[tex]Each rectangle in the figure below is congruent and measures 2 cm x 1/2 cm what is the term perimete[/tex]
Similar Solved Works
3 answers
A car is purchased for $21,500. After each year, the resale value decreases by 25%. What will the resale value be after 5 years?
A car is purchased for $21,500. After each year, the resale value decreases by 25%. What will the resale value be after 5 years?...
3 answers
A triangular pane of glass has a height of 46 inches and an area of 414 square inches. What is the length of the base of the pane?Help
A triangular pane of glass has a height of 46 inches and an area of 414 square inches. What is the length of the base of the pane? Help Please!...
4 answers
Tengo sueño. esta telenovela. me aburre le aburre me fascinan me aburren
Tengo sueño. esta telenovela. me aburre le aburre me fascinan me aburren...
4 answers
Nancy created a graph to predict the pay she will take home after taxes are taken from her income. Using
Nancy created a graph to predict the pay she will take home after taxes are taken from her income. Using the information on the graph, what is the constant of proportionality? A line graph titled Nancy's Pay has Nancy's Income on the x-axis and Take Home Pay on the y-axis. At 60 dollars of income, ...
4 answers
The function f(x) is a quartic function and the zeros of f(x) are −4, −2, 1 and 5. The y-intercept of f(x) is 120. Write
The function f(x) is a quartic function and the zeros of f(x) are −4, −2, 1 and 5. The y-intercept of f(x) is 120. Write the equation of the quartic polynomial in standard form....
3 answers
Give the description and un agency for each global issue: global culture and heritage
Give the description and un agency for each global issue: global culture and heritage preservation climate change health and medicine human rights weapon of mass destruction global trade access to water energy sources terrorism and counterterrorism technological change...
4 answers
What is 140 million in scientific notation
What is 140 million in scientific notation...
10 answers
Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this
Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which it would predominantly appear in the cell. label the termini. b. draw the result of translation in atomic detail (i. e. chem...
9 answers
Assume that lines that appear tangent are tangent. find the value of each variable.
Assume that lines that appear tangent are tangent. find the value of each variable. [tex]Assume that lines that appear tangent are tangent. find the value of each variable.[/tex]...
10 answers
Ronny read for 2.75 hours yesterday. his older brother read for 1.18 hours and his younger brother read for 0.43 hours.
Ronny read for 2.75 hours yesterday. his older brother read for 1.18 hours and his younger brother read for 0.43 hours. how much longer did ronny read than his two brothers combined?...
10 answers
Does the sentence contain faulty parallel structure? the schools not only were closed because of the
Does the sentence contain faulty parallel structure? the schools not only were closed because of the snow and ice but also because of the lack of heat....
3 answers
Hi everybody! can some one me? ! : ) 30 !
Hi everybody! can some one me? ! : ) 30 ! [tex]Hi everybody! can some one me? ! : ) 30 ![/tex]...
3 answers
<7 and <8 are complimentary angles. <5 = <8 and m<6 = 29. Find the measure of angle 7 and angle 5
<7 and <8 are complimentary angles. <5 = <8 and m<6 = 29. Find the measure of angle 7 and angle 5 [tex]<7 and <8 are complimentary angles. <5 = <8 and m<6 = 29. Find the measure of angle[/tex]...
4 answers
Why might russia have felt threatened by the austro-german-romanian alliance?
Why might russia have felt threatened by the austro-german-romanian alliance?...
7 answers
Choose the answer that correctly completes the sentence. cuando necesitas (3 points)
Choose the answer that correctly completes the sentence. cuando necesitas (3 points)...
6 answers
Look at the following equation.__Au2O3 → _Au + _02In order to follow the law of conservation of mass, this equation must have which set of coefficients
Look at the following equation. __Au2O3 → _Au + _02 In order to follow the law of conservation of mass, this equation must have which set of coefficients in order from left to right? A. 2,4,3 B. 1,3,1 C. 2,1,3 D. 1,1,3...
3 answers
From your classroom set-up, what research topic can you formulate?
From your classroom set-up, what research topic can you formulate?...
5 answers
Select ALL the right triangles, given the lengths of the sides.
Select ALL the right triangles, given the lengths of the sides. [tex]Select ALL the right triangles, given the lengths of the sides.[/tex]...
10 answers
HELP PLEASE DOING A QUIZWhich of the following is not an example of a graphic you would find in your text?A. Information
HELP PLEASE DOING A QUIZ Which of the following is not an example of a graphic you would find in your text? A. Information box B. Chart C. Subheading D. Illustration...